Watch Anime Online
New Episodes: naruto one piece bleach trigun kenichi inuyasha devil may cry deathnote claymore
User: EyeMJRhardcore |
Negative A - Polymerase Chain Reaction http://www.discogs.com/release/1365028 Tags: Negative Polymerase Chain Reaction |
User: penchevsct |
Polymerase chain reaction (PCR) polymerase chain reaction Tags: DNA molecular biology biochemistry |
User: GautamRangan |
polymerase chain reaction Taq polymerase is used to replicate targeted portions of the genome during a cycle of heating and cooling. The process may be repeated thirty or forty times to get the right quantity of DNA by Gautam Rangan Tags: DNA polymerase chain reaction PCR Gautam Rangan |
User: alokkms |
Polymerase Chain Reaction Procedure of polymerase chain reaction Tags: pcr |
User: andylabtech |
Phire DNA polymerase Phire DNA polymerase Tags: DNA polymerase |
User: nielssnakey |
negative a - polymerase chain reaction hardcore darkcore industrial tekno terror early rave Tags: hardcore darkcore industrial tekno terror early rave |
User: vs575 |
Polymerase Chain Reaction (PCR) Song an hymn to the technique widely used in molecular biology Tags: polymerase chain reaction PCR |
User: plataformaFG |
Polymerase Chain Reaction Polymerase Chain Reaction Tags: biotecnologia reaccion Polymerase agricultura |
User: chick16Landon |
polymerase DNA all of us .... Tags: dna sara video |
User: FreeScienceLectures |
DNA Replication Process http://www.FreeScienceLectures.com We travel inside nucleus to see how the DNA replicates. When DNA replicates its strands are separated by enzine helicase. Single-stranded DNA binding proteines keep the strands from (...?). One DNA strand encodes the leading strand using DNA Polymerase III. Just watch to see what is going on. --- It's Never too Late to Study: http://www.FreeScienceLectures.com --- Notice: This video is copyright by its respectful owners. The website address on the video does not mean anything. --- Tags: dna replication enzine helicase strand polymerase encode okazaki fragments rna primase primer ligase |
User: cdk007 |
Big Numbers: a Concept Creationists Don't Understand This video rests on one assumption, that mutations are a constant fact of life. Is this valid? Yes. Three common causes of mutations are radicals, ionizing radiation, and polymerase errors. Radicals are a constant given the chemistry of the earth. Ionizing radiations has existed long before life. And no polymerase is perfect. Therefore, mutations have occurred in the past and continue to occur today. To download this video go to: http://www.mediafire.com/?etw9jv1mu4n Learn the facts, spread the truth, and most importantly, Think About It. Tags: Evolution Intelligent Design ID Creation evidence facts education DNA mutation time human chimpanzee common ancestor |
User: quantalord |
RNA polymerase II domains RNA polymerase II Tags: RNA polymerase protein domains |
User: landscape0103 |
polymerase chain reaction Thank you for seeing this art work. I experimentally made this music. If there is an opinion When it gives me the report, it is glad=) http://www.myspace.com/atsushi0103 Tags: ambient avant-garde Electronica Experiment fantasy IDM music Psychedelic Rock Sci-Fi Surréalisme |
User: zizyoutb |
DNA. Amplification par PCR L'amplification du DNA par PCR comporte la preparation d'un melange reactionnel contenant, entre autre, le DNA, les amorces (primers) et la DNA polymerase. L'amplification par PCR exige la dénaturation du DNA, la fixation des amorces et l'élongation Tags: DNA PCR amplification polymerase |
User: Wartez |
The Plastic Chord Live: Polymerase Chain Reaction (7 of 9) The Plastic Chord Live: Polymerase Chain Reaction (7 of 9) Tags: Plastic Chord Live Polymerase Chain Reaction |
User: videoactive |
01-28-2008 Hawthorne Videoactive Report Ensequence Says Two-Thirds Want To Interact With Advertising Via iTV; KFC Seeks Chicken Dance Footage; Dimension One Spas Runs Sweetheart Of A Hot Tub Contest; Bio-Rad Scientists Create Viral Video About Polymerase Chain Reactions. Tags: ensequence polymerase kfc advertising dimension one spas itv interactive tv commercial colonel chicken dance party |
User: DOCTORFABIANO |
DNA replication Medical Molecular Biology DNA Polymerase, Helicase, Lag strand Tags: Medical Molecular Biology DNA Polymerase Helicase Lag strand replication |
User: drrufusrajadurai |
HIV Replication 3D Animation it is a very excellent animation which explains the hiv replication very clearly. For free download of this video please visit my webpage http://rufusrajadurai.wetpaint.com/page/Download And other 3D animation videos visit http://rufusrajadurai.wetpaint.com/page/3D+Medical+Animation+Library Regards, Dr.Rufus The Lyrics of this video is here Targeting HIV replication The replication of HIV 1 is a multi-stage process. Each step is crucial to successful replication and is therefore a potential target of antiretroviral drugs. Step one is the infection of a suitable host-cell, such as a CD4-positive T-lymphocyte. Entry of HIV into the cell requires the presence of certain receptors on the cell surface, CD4 -- receptors and co-receptors such as CCR5 or CXCR4. These receptors interact with protein-complexes, which are embedded in the viral envelope. These complexes are composed of two glycoproteins: an extracellular gp 120 and a transmembrane gp 41 When HIV approaches the target cell gp120 binds to the CD4-receptors. This process is termed attachment. It promotes further binding to a co-receptor. Co-receptor binding results in a conformational change in gp120. This allows gp41 to unfold and insert its hydrophobic terminus into the cell membrane. Gp 41 then folds back on itself. This draws the virus towards the cell and facilitates the fusion of their membranes. The viral nucleocapsid enters the host cell and breaks open releasing two viral RNA-strands and 3 essential replication enzymes: Integrase, Protease and Reverse Transcriptase. Reverse Transcriptase begins the reverse transcription of viral RNA. It has two catalytic domains: The Ribonuclease-H active site And the polymerase active site Here single stranded viral RNA is transcribed into an RNA-DNA double helix. Ribonuclease- H breaks down the RNA. The polymerase then completes the remaining DNA-strand to form a DNA -- double helix. Now Integrase goes into action. It cleaves a dinucleotide from each 3-prime end of the DNA creating two sticky ends. Integrase then transfers the DNA into the cell nucleus and facilitates its integration into the host cell genome. The host cell genome now contains the genetic information of HIV. Activation of the cell induces transcription of proviral DNA into messenger RNA. The viral messenger RNA migrates into the cytoplasm where building blocks for a new virus are synthesised. Some of them have to be processed by the viral protease. Protease cleaves longer proteins into smaller core proteins. This step is crucial to create an infectious virus. Two viral RNA-strands and the replication enzymes then come together and core proteins assemble around them forming the capsid. This immature particle leaves the cell acquiring a new envelope of host and viral proteins. The virus matures and becomes ready to infect other cells. HIV replicates billions of times per day destroying the hosts` immune cells and eventually causing disease progression. Drugs which interfere with the key steps of viral replication can stop this fatal process. Entry into the host cell can be blocked by fusion inhibitors for example. Inhibition of reverse transcriptase by nucleoside inhibitors or by non-nucleoside Reverse Transcriptase- inhibitors is part of standard antiretroviral regimens. The action of Integrase can be blocked. Protease inhibitors are also part of standard antiretroviral therapy. Each blocked step in viral replication is a step towards better control of HIV disease. Script, Storyboard, Art Direction by: Frank Schauder, MD Animation: MACKEVISION Publicity: Dr.Rufus Rajadurai.M.D.,D.N.S., Tags: hiv replication medical animation |
User: nhaskins401 |
Arylamines DNA adduct (environmental carcinogens) Arylamines belong to an important class of environmental carcinogens which are implicated in the etiology of many human cancers. 2-Aminofluorene and its derivatives are prototype arylamine carcinogens that form two DNA adducts in vivo: AF and AAF. AF is the major and most persistent adduct. It is known to exist in a sequence-dependent equilibrium between external B-type and stacked S-conformers, as defined by the location (major groove and base-displaced, respectively) of the carcinogen moiety. A minor groove binding wedged (W)-conformer has also been observed in duplexes in which the lesion is mismatched with purine bases. The dynamics of the AF-induced B/S/W-heterogeneity have been shown to be modulated by both the base sequence contexts and the progression for the length of primers, and contribute to polymerase activity through a long-range effect. The sequence effects on adduct conformation and the nature of the polymerase are key factors for determining the mutational outcomes of these important carcinogens. This animation shows the rotating views of the external B-type (B), base-displaced stacked (S), minor groove wedge (W)-conformers. The modified dG and the complementary dC are shown in cyan and green CPK, respectively, and the aminofluorene carcinogen moiety is highlighted with red CPK. Nathan Haskins/Dr. Bongsup Cho Tags: maya neight nhaskins arylamines science visulization cho URI environmental carcinogens |
User: rtfwathunter |
RT-PCR 1 Maya giving a talk at Hnter college; sorry for the poor quaility bc iSight was not behaving as usual. Tags: retrovirus reverse transcriptase polymerase chain reaction biology gene expression hunter college high school |
User: JesterOfKings |
Protein Synthesis Claymation I know the animation and photo quality aren't all that great, but it took a while. I made it with JPEG video, a stop motion animation program and I edited it in Windows Movie Maker. It is 15 frames per second and 341 pictures. This video shows transcription of DNA to RNA and translation of RNA to a polypeptide. Here is a slightly more detailed explanation of what is happening because a few things had to be cut: The DNA polymerase (not shown in movie) unzips the DNA. Then the RNA forms, by matching each guanine (G) of the DNA to RNA's cytosine (C) and vice versa; and matching each thymine (T) to adenine (A); and each A to uracil (U). In the movie, T is red, C is brown, G is blue, A is yellow, and U is green. The movie doesn't show this, but the RNA is made by matching each nucleotide one at a time, instead of coming in fully formed as the movie depicts. The enzyme called RNA polymerase is what catalyzes this process, but that also isn't shown in the movie. The DNA goes back together in helix form and the mRNA (messenger RNA, which was just made) moves to the ribosome, an organelle. The ribosome is made up of protein and RNA called rRNA (ribosomal RNA). This is where translation begins. Only two codons (a section of RNA with three nucleotides) can fit in the ribosome at a time. The tRNA (transfer RNA), which are the brown crosses with nucleotides, come into the ribosome. The nucleotides on the bottom of the tRNA, called anti-codons, match the codons of the mRNA. Each tRNA is attached to a specific amino acid, which are the colored balls in the video. The type of amino acid is based on the codon on the mRNA that the tRNA matches. The codons in this video code for Valine, Aspartate, Threonine, Histidine, Tyrosine, and Phenylalanine. The last codon doesn't have a matching tRNA because it is a stop codon which signals for the translation process to stop. These amino acids bond through dehydration synthesis as the process continues to form a polypeptide, thus making protein. DNA code used in video that was transcribed: CAACTGTGTGTAATAAAGATC RNA code that was transcribed from above DNA and then translated: GUUGACACACAUUAUUUCUAG Tags: biology protein synthesis claymation stop motion stopmotion dna rna polypeptide science |
User: rtfwathunter |
RT-PCR 2 Maya giving a talk at hunter; sorry for the poor quaility bc iSight was not behaving as usual. Tags: retrovirus reverse transcriptase polymerase chain reaction RT PCR biology hunter college high school |
User: Genesinconflict |
Selfish Sex Chromosomes 1 Genes in Conflict Selfish Genetic Elements Intragenomic Conflict Chromosomes DNA Feminizing X cDNA library Chromosomal Microdissection Degenerated Oligonucleotide Primed Polymerase Chain Reaction PCR Fluorescence in situ Hybridization Probe Myopus schisticolor Wood Lemming Interference Tags: Myopus schisticolor wood lemming feminizing Genes in Conflict Selfish sex Genetic Elements Chromosomes DNA |
User: Genesinconflict |
Selfish Sex Chromosomes 2 Genes in Conflict Selfish Genetic Elements Intragenomic Conflict Chromosomes DNA Feminizing X cDNA library Chromosomal Microdissection Degenerated Oligonucleotide Primed Polymerase Chain Reaction PCR Fluorescence in situ Hybridization Probe Myopus schisticolor Wood Lemming Interference Deletion Inversion ccth dax1 XH2 SRY Southern Blot Tags: Myopus schisticolor wood lemming feminizing Genes in Conflict Selfish sex Genetic Elements Chromosomes DNA |
User: yuukosakura |
PCR não sei de onde é este vídeo! mas é para ajudar akeles q precisam entender! :) Tags: PCR polymerase chain reaction reação cadeia polimerase |
Pages: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
Watch Youtube Video - Watch Anime Online